D11Mit151 Primer Detail MGI Mouse MGI:702344

D11Mit151 Primer Detail

Name

D11Mit151
Primer 1 Sequence

TGGGAATTCTGGGAGTTCTG
Primer 2 Sequence

GTTGGTCTGTTATGAAGACCAGG
ID

MGI:702344
Product Size

140
Other IDs

D11Mit151 (BROAD)
Note

MIT assay: MT976
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 151

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit151	a	142bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	144bp	A/J, DBA/2J
	c	154bp	BALB/cJ, CAST/EiJ, LP/J
	d	156bp	NON/ShiLt
	e	158bp	AKR/J, NOD/MrkTac
	f	180bp	SPRET/EiJ

J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit151	c	lower	CBA/Kw
	D11Mit151	k	upper	KE

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit151	b	lower	C57BL/6J
	D11Mit151	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23