About   Help   FAQ
D11Mit152 Primer Detail
Primers
  • Name
    D11Mit152
  • Primer 1 Sequence
    TGCTAAGTTTTTCTTTGCTGAGG
  • Primer 2 Sequence
    AGCCCTCAGAGGCCTCATAT
  • ID
    MGI:702343
  • Product Size
    133
  • Other IDs
    D11Mit152 (BROAD)
  • Note
    MIT assay: MT1183
    Additional information: MIT STS Marker Data Files
Genes
D11Mit152 DNA segment, Chr 11, Massachusetts Institute of Technology 152
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit152 a 135bp DBA/2J
b 137bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
c 143bp NOD/MrkTac, NON/ShiLt
d 149bp BALB/cJ, CAST/EiJ, LP/J
e 155bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit152 c 135bp CBA/CaOlaHsd
s 128bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory