D6Mit15 Primer Detail MGI Mouse MGI:702338

D6Mit15 Primer Detail

Name

D6Mit15
Primer 1 Sequence

CACTGACCCTAGCACAGCAG
Primer 2 Sequence

TCCTGGCTTCCACAGGTACT
ID

MGI:702338
Product Size

253
Other IDs

D6Mit15 (BROAD)
Note

MIT assay: M148
Additional information: MIT STS Marker Data Files

D6Mit15

DNA segment, Chr 6, Massachusetts Institute of Technology 15

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit15	a	195bp	129X1/Sv
Not Specified	D6Mit15	f	150, 160bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit15	c	195bp	C3HeB/FeJLe
	D6Mit15	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit15	a	150bp	NOD/MrkTac
	b	195bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	c	220bp	CAST/EiJ
	d	260bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt, SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D6Mit15	c	largest	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit15	l	larger	LG/J
	D6Mit15	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D6Mit15	a	260bp	AKR/W, C57BL/6W, C57BL/10W
	b	195bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
	c	170bp	129/SvW

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23