About   Help   FAQ
D6Mit14 Primer Detail
Primers
  • Name
    D6Mit14
  • Primer 1 Sequence
    ATGCAGAAACATGAGTGGGG
  • Primer 2 Sequence
    CACAAGGCCTGATGACCTCT
  • ID
    MGI:702337
  • Product Size
    157
  • Other IDs
    D6Mit14 (BROAD)
  • Note
    MIT assay: M190
    Additional information: MIT STS Marker Data Files
Genes
D6Mit14 DNA segment, Chr 6, Massachusetts Institute of Technology 14
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D6Mit14 b not given C57BL/6J
c 149bp C3HeB/FeJLe
f largest FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit14 a largest C57BL/6, MSM/Ms
b smaller DBA/2, JF1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit14 m 160bp MOLF/EiJ
s 156bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit14 a 149bp AKR/J, C3H/HeJ, DBA/2J
b 152bp BALB/cJ
c 156bp A/J
d 160bp B6.Cg-Lepob/+, C57BL/6J
e 168bp LP/J
f 172bp CAST/EiJ
g 174bp NOD/MrkTac, NON/ShiLt, SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D6Mit14 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D6Mit14 b 157bp C57BL/6JOlaHsd, C57BL/10
c 155bp 129P3/J, A/JOlaHsd, BALB/cJ
d 147bp AKR/OlaHsd, C3H/HeJ, DBA/2J, JF1, PWB, SJL/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D6Mit14 l smaller LG/J
s larger SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory