D6Mit14 Primer Detail MGI Mouse MGI:702337

D6Mit14 Primer Detail

Name

D6Mit14
Primer 1 Sequence

ATGCAGAAACATGAGTGGGG
Primer 2 Sequence

CACAAGGCCTGATGACCTCT
ID

MGI:702337
Product Size

157
Other IDs

D6Mit14 (BROAD)
Note

MIT assay: M190
Additional information: MIT STS Marker Data Files

D6Mit14

DNA segment, Chr 6, Massachusetts Institute of Technology 14

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D6Mit14	b	not given	C57BL/6J
	c	149bp	C3HeB/FeJLe
	f	largest	FVB/N

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit14	a	largest	C57BL/6, MSM/Ms
Not Specified	D6Mit14	b	smaller	DBA/2, JF1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit14	m	160bp	MOLF/EiJ
Not Specified	D6Mit14	s	156bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit14	a	149bp	AKR/J, C3H/HeJ, DBA/2J
	b	152bp	BALB/cJ
	c	156bp	A/J
	d	160bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	168bp	LP/J
	f	172bp	CAST/EiJ
	g	174bp	NOD/MrkTac, NON/ShiLt, SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D6Mit14	c	smaller	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D6Mit14	b	157bp	C57BL/6JOlaHsd, C57BL/10
	c	155bp	129P3/J, A/JOlaHsd, BALB/cJ
	d	147bp	AKR/OlaHsd, C3H/HeJ, DBA/2J, JF1, PWB, SJL/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit14	l	smaller	LG/J
	D6Mit14	s	larger	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24