About   Help   FAQ
D6Mit10 Primer Detail
Primers
  • Name
    D6Mit10
  • Primer 1 Sequence
    TCAGAGGAACAAAGCAGCAT
  • Primer 2 Sequence
    CCTGTGGCTAACAGGTAAAA
  • ID
    MGI:702333
  • Product Size
    200
  • Other IDs
    D6Mit10 (BROAD)
  • Note
    MIT assay: M78
    Additional information: MIT STS Marker Data Files
Genes
D6Mit10 DNA segment, Chr 6, Massachusetts Institute of Technology 10
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit10 a 191bp 129X1/Sv
f 198bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit10 a 191bp C3H/HeJ, NOD/MrkTac
b 198bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
c 206bp DBA/2J
d 207bp NON/ShiLt
e 210bp CAST/EiJ
f 212bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D6Mit10 a 206bp 129/SvW, A.CA/W, BALB/cW, BN/aW, CBA/W, DBA/2W
b 198bp AKR/W, C57BL/6W, C57BL/10W
c 191bp C3H/W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory