About   Help   FAQ
D6Mit105 Primer Detail
Primers
  • Name
    D6Mit105
  • Primer 1 Sequence
    CTGTCTCCACTACTTCTATTCCTGG
  • Primer 2 Sequence
    CAAAAGCCTTATATATTACACCTCACC
  • ID
    MGI:702316
  • Product Size
    237
  • Other IDs
    D6Mit105 (BROAD)
  • Note
    MIT assay: MPC1203
    Additional information: MIT STS Marker Data Files
Genes
D6Mit105 DNA segment, Chr 6, Massachusetts Institute of Technology 105
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit105 a 234bp 129X1/Sv
f 222, 234bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit105 a 208bp SPRET/EiJ
b 214bp CAST/EiJ, NON/ShiLt
c 218bp DBA/2J
d 220bp A/J
e 222bp AKR/J, BALB/cJ, C3H/HeJ, LP/J
f 234bp B6.Cg-Lepob/+, C57BL/6J
g 238bp NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D6Mit105 a 225bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ
b 235bp C57BL/6JOlaHsd, C57BL/10
c 223bp BALB/cJ
d 219bp DBA/2J, JF1, PWB
l 211bp SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory