D13Mit210 Primer Detail MGI Mouse MGI:702314

D13Mit210 Primer Detail

Name

D13Mit210
Primer 1 Sequence

GTGTAAGAAAAAAGTTTCTTCAAATCG
Primer 2 Sequence

TCAGCCTGCTTCAAAATGC
ID

MGI:702314
Product Size

141
Other IDs

D13Mit210 (BROAD)
Note

MIT assay: MT3531
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 210

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit210	a	130bp	AKR/J, C3H/HeJ
	b	142bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	164bp	CAST/EiJ
	d	170bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit210	a	142bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, DBA/2W
	D13Mit210	b	130bp	AKR/W, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24