About   Help   FAQ
D13Mit210 Primer Detail
Primers
  • Name
    D13Mit210
  • Primer 1 Sequence
    GTGTAAGAAAAAAGTTTCTTCAAATCG
  • Primer 2 Sequence
    TCAGCCTGCTTCAAAATGC
  • ID
    MGI:702314
  • Product Size
    141
  • Other IDs
    D13Mit210 (BROAD)
  • Note
    MIT assay: MT3531
    Additional information: MIT STS Marker Data Files
Genes
D13Mit210 DNA segment, Chr 13, Massachusetts Institute of Technology 210
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit210 a 130bp AKR/J, C3H/HeJ
b 142bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 164bp CAST/EiJ
d 170bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D13Mit210 a 142bp 129/SvW, A.CA/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, DBA/2W
b 130bp AKR/W, C3H/W, CBA/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory