About   Help   FAQ
D13Mit216 Primer Detail
Primers
  • Name
    D13Mit216
  • Primer 1 Sequence
    AAGCCACTGTCTGTCACACTG
  • Primer 2 Sequence
    GCTAAGGAAACTAAGGTGAACTCTG
  • ID
    MGI:702309
  • Product Size
    120
  • Other IDs
    D13Mit216 (BROAD)
  • Note
    MIT assay: MTAR4144
    Additional information: MIT STS Marker Data Files
Genes
D13Mit216 DNA segment, Chr 13, Massachusetts Institute of Technology 216
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit216 a 114bp 129X1/Sv
f 98, 114bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit216 a 98bp SPRET/EiJ
b 112bp CAST/EiJ
c 114bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
d 118bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory