D18Mit62 Primer Detail MGI Mouse MGI:702263

D18Mit62 Primer Detail

Name

D18Mit62
Primer 1 Sequence

TGCAATTTCCCCAATTCTTG
Primer 2 Sequence

AAATAAAGGAGGACAGCACATAGC
ID

MGI:702263
Product Size

155
Other IDs

D18Mit62 (BROAD)
Note

MIT assay: MPC934
Additional information: MIT STS Marker Data Files

D18Mit62

DNA segment, Chr 18, Massachusetts Institute of Technology 62

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit62	m	160bp	MOLF/EiJ
Not Specified	D18Mit62	s	180bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit62	a	138bp	SPRET/EiJ
	b	154bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	c	160bp	C3H/HeJ
	d	164bp	AKR/J, CAST/EiJ, NON/ShiLt

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13