D18Mit60 Primer Detail MGI Mouse MGI:702260

D18Mit60 Primer Detail

Name

D18Mit60
Primer 1 Sequence

ACCTGACACCATTTTCAGGC
Primer 2 Sequence

ATCCTTGAGCCTGTTAAAAGACA
ID

MGI:702260
Product Size

205
Other IDs

D18Mit60 (BROAD)
Note

MIT assay: MPC1605
Additional information: MIT STS Marker Data Files

D18Mit60

DNA segment, Chr 18, Massachusetts Institute of Technology 60

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit60	C	174bp	C3HeB/FeJLe
	D18Mit60	f	larger	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit60	m	246bp	MOLF/EiJ
Not Specified	D18Mit60	s	238bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit60	a	174bp	C3H/HeJ, CAST/EiJ
	b	176bp	BALB/cJ
	c	180bp	AKR/J, LP/J, NON/ShiLt
	d	184bp	SPRET/EiJ
	e	186bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	188bp	NOD/MrkTac
	g	194bp	A/J, DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D18Mit60	b	207bp	C57BL/6JOlaHsd, C57BL/10
	c	191bp	BALB/cJ, C3H/HeJ
	d	215bp	A/JOlaHsd, DBA/2J
	j	203bp	JF1
	p	199bp	129P3/J, AKR/OlaHsd, PWB, SJL/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit60	c	212bp	CBA/CaOlaHsd
	D18Mit60	s	198bp	SWR/OlaHsd

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit60	c	larger	CBA/Kw
	D18Mit60	e	smaller	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23