About   Help   FAQ
D9Mit129 Primer Detail
Primers
  • Name
    D9Mit129
  • Primer 1 Sequence
    TTGTCTTTTAACCTCCTGGAGC
  • Primer 2 Sequence
    TCCCATCTTTCTCCTTGTGG
  • ID
    MGI:702241
  • Product Size
    132
  • Other IDs
    D9Mit129 (BROAD)
  • Note
    MIT assay: MT185
    Additional information: MIT STS Marker Data Files
Genes
D9Mit129 DNA segment, Chr 9, Massachusetts Institute of Technology 129
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit129 a 132bp B6.Cg-Lepob/+, C57BL/6J
b 150bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, SPRET/EiJ
c 156bp CAST/EiJ
d 160bp AKR/J, NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit129 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D9Mit129 a 160bp AKR/W
b 150bp 129/SvW, AKR/W, DBA/2W
c 136bp BN/aW
d 132bp C57BL/6W, C57BL/10W, CBA/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory