About   Help   FAQ
D8Mit56 Primer Detail
Primers
  • Name
    D8Mit56
  • Primer 1 Sequence
    ACACTCAGAGACCATGAGTACACC
  • Primer 2 Sequence
    GAGTTCACTACCCACAAGTCTCC
  • ID
    MGI:702224
  • Product Size
    162
  • Other IDs
    D8Mit56 (BROAD)
  • Note
    MIT assay: B740
    Additional information: MIT STS Marker Data Files
Genes
D8Mit56 DNA segment, Chr 8, Massachusetts Institute of Technology 56
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D8Mit56 c 164bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit56 a 152bp SPRET/EiJ
b 160bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
c 164bp A/J, AKR/J, BALB/cJ, C3H/HeJ
d 180bp NOD/MrkTac
e 182bp DBA/2J, LP/J
f 184bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D8Mit56 l larger LG/J
s smaller SM/J
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit56 a larger 129P3/J
s smaller SJL/J
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D8Mit56 c upper CBA/Kw
e lower KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory