About   Help   FAQ
D6Mit4 Primer Detail
Primers
  • Name
    D6Mit4
  • Primer 1 Sequence
    ACTAGGAAACACACTGATTCATATG
  • Primer 2 Sequence
    GAGGTGACAAAATTTTCAAAAA
  • ID
    MGI:702220
  • Product Size
    98
  • Other IDs
    D6Mit4 (BROAD)
  • Note
    MIT assay: M239
    Additional information: MIT STS Marker Data Files
Genes
D6Mit4 DNA segment, Chr 6, Massachusetts Institute of Technology 4
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit4 a 102bp 129X1/Sv
F 90, 95bp CD-1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit4 m 108bp MOLF/EiJ
s 112bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit4 a 90bp A/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
b 95bp AKR/J
c 102bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
d 107bp CAST/EiJ
e 108bp LP/J
f 121bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D6Mit4 l smaller LG/J
s larger SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory