About   Help   FAQ
D6Mit1 Primer Detail
Primers
  • Name
    D6Mit1
  • Primer 1 Sequence
    GGCACATTTGCCTTTGTTTT
  • Primer 2 Sequence
    TCTCCTATCTCTCCACCTTTTCC
  • ID
    MGI:702218
  • Product Size
    220
  • Other IDs
    D6Mit1 (BROAD)
  • Note
    MIT assay: A10
    Additional information: MIT STS Marker Data Files
Genes
D6Mit1 DNA segment, Chr 6, Massachusetts Institute of Technology 1
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D6Mit1 c 242bp C3HeB/FeJLe
f smaller FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit1 m 260bp MOLF/EiJ
s 300bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit1 a 214bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
b 237bp CAST/EiJ
c 242bp BALB/cJ, C3H/HeJ, NON/ShiLt
d 278bp SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D6Mit1 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D6Mit1 a 242bp BALB/cW, C3H/W, CBA/W
b 214bp 129/SvW, A.CA/W, AKR/W, BN/aW, C57BL/6W, C57BL/10W, DBA/2W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory