D6Mit1 Primer Detail MGI Mouse MGI:702218

D6Mit1 Primer Detail

Name

D6Mit1
Primer 1 Sequence

GGCACATTTGCCTTTGTTTT
Primer 2 Sequence

TCTCCTATCTCTCCACCTTTTCC
ID

MGI:702218
Product Size

220
Other IDs

D6Mit1 (BROAD)
Note

MIT assay: A10
Additional information: MIT STS Marker Data Files

D6Mit1

DNA segment, Chr 6, Massachusetts Institute of Technology 1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit1	c	242bp	C3HeB/FeJLe
	D6Mit1	f	smaller	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit1	m	260bp	MOLF/EiJ
Not Specified	D6Mit1	s	300bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit1	a	214bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	b	237bp	CAST/EiJ
	c	242bp	BALB/cJ, C3H/HeJ, NON/ShiLt
	d	278bp	SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit1	l	larger	LG/J
	D6Mit1	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit1	a	242bp	BALB/cW, C3H/W, CBA/W
	D6Mit1	b	214bp	129/SvW, A.CA/W, AKR/W, BN/aW, C57BL/6W, C57BL/10W, DBA/2W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24