About   Help   FAQ
D13Mit110 Primer Detail
Primers
  • Name
    D13Mit110
  • Primer 1 Sequence
    ACAGAGAGCGTCCATGTGC
  • Primer 2 Sequence
    TGTAAAGCTCCACCCACTCC
  • ID
    MGI:702202
  • Product Size
    161
  • Note
    MIT assay: MPC1044
Genes
D13Mit110 DNA segment, Chr 13, Massachusetts Institute of Technology 110
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit110 a 162bp 129X1/Sv
f 158, 162bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit110 a 154bp A/J
b 158bp C3H/HeJ, LP/J, NON/ShiLt
c 160bp AKR/J
d 162bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
e 166bp DBA/2J
f 170bp SPRET/EiJ
g 176bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D13Mit110 c 131bp CBA/CaOlaHsd
s 130bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory