D5Mit338 Primer Detail MGI Mouse MGI:702185

D5Mit338 Primer Detail

Name

D5Mit338
Primer 1 Sequence

CCCATAATGTATATTTCATCAGACG
Primer 2 Sequence

TTTTTGCCCAGTGCTATGTG
ID

MGI:702185
Product Size

119
Other IDs

D5Mit338 (BROAD)
Note

MIT assay: MTH668
Additional information: MIT STS Marker Data Files

D5Mit338

DNA segment, Chr 5, Massachusetts Institute of Technology 338

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit338	a	119bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	b	131bp	AKR/J
	c	143bp	C3H/HeJ, NON/ShiLt
	d	145bp	CAST/EiJ
	e	149bp	A/J, BALB/cJ, LP/J, NOD/MrkTac

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit338	c	upper	CBA/Kw
	D5Mit338	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24