About   Help   FAQ
D1Mit288 Primer Detail
Primers
  • Name
    D1Mit288
  • Primer 1 Sequence
    TGAAATTGGGAACTCACGTG
  • Primer 2 Sequence
    CCATTGTTTTGCTATCCTTTCC
  • ID
    MGI:702142
  • Product Size
    148
  • Other IDs
    D1Mit288 (BROAD)
  • Note
    MIT assay: MT3155
    Additional information: MIT STS Marker Data Files
Genes
D1Mit288 DNA segment, Chr 1, Massachusetts Institute of Technology 288
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit288 a 134bp NON/ShiLt
b 154bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
c 156bp DBA/2J, NOD/MrkTac
d 158bp A/J, C3H/HeJ
e 188bp CAST/EiJ
f 202bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit288 c 133bp CBA/CaOlaHsd
s 165bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory