About   Help   FAQ
D5Mit287 Primer Detail
Primers
  • Name
    D5Mit287
  • Primer 1 Sequence
    TAAAGACCTCATTGCCCCAC
  • Primer 2 Sequence
    GTGATCGGAGGCAAGATAGC
  • ID
    MGI:702128
  • Product Size
    149
  • Other IDs
    D5Mit287 (BROAD)
  • Note
    MIT assay: MT592
    Additional information: MIT STS Marker Data Files
Genes
D5Mit287 DNA segment, Chr 5, Massachusetts Institute of Technology 287
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit287 a 131bp 129X1/Sv
f 123, 131bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit287 a 131bp AKR/J, NOD/MrkTac
b 141bp SPRET/EiJ
c 143bp A/J, BALB/cJ, C3H/HeJ
d 149bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit287 a larger 129P3/J
s smaller SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory