About   Help   FAQ
D5Mit48 Primer Detail
Primers
  • Name
    D5Mit48
  • Primer 1 Sequence
    GACTATCATCCAAGCCAAGACC
  • Primer 2 Sequence
    AAAAGACACTTTCCCTGACATAGC
  • ID
    MGI:702123
  • Product Size
    199
  • Other IDs
    D5Mit48 (BROAD)
  • Note
    MIT assay: D653
    Additional information: MIT STS Marker Data Files
Genes
D5Mit48 DNA segment, Chr 5, Massachusetts Institute of Technology 48
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D5Mit48 b larger than f C57BL/6J
c 206bp C3HeB/FeJLe
f smaller than c and b FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit48 a 150bp NOD/MrkTac, SPRET/EiJ
b 194bp LP/J
c 198bp BALB/cJ
d 202bp NON/ShiLt
e 206bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
f 208bp AKR/J
g 210bp DBA/2J
h 230bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D5Mit48 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit48 c 202bp CBA/CaOlaHsd
s 199bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory