About   Help   FAQ
D7Mit74 Primer Detail
Primers
  • Name
    D7Mit74
  • Primer 1 Sequence
    GACCACCACTGCCTGTTTTT
  • Primer 2 Sequence
    GGTTGGGCTGTGCATAGG
  • ID
    MGI:702120
  • Product Size
    115
  • Note
    MIT assay: MPC1510
Genes
D7Mit74a DNA segment, Chr 7, Massachusetts Institute of Technology 74a
D7Mit74b DNA segment, Chr 7, Massachusetts Institute of Technology 74b
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit74a m 115bp MOLF/EiJ
s 121bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit74a a 112bp NON/ShiLt
b 116bp A/J, BALB/cJ, NOD/MrkTac
c 118bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
d 128bp SPRET/EiJ
e 130bp AKR/J
f 132bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit74a c 112bp CBA/CaOlaHsd
s 106bp SWR/OlaHsd
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory