D5Mit43 Primer Detail MGI Mouse MGI:702116

D5Mit43 Primer Detail

Name

D5Mit43
Primer 1 Sequence

TTATAGGCACGAACTGTCATGC
Primer 2 Sequence

GTCCCCTCACCCACTTGTAA
ID

MGI:702116
Product Size

131
Other IDs

D5Mit43 (BROAD)
Note

MIT assay: B423
Additional information: MIT STS Marker Data Files

D5Mit43

DNA segment, Chr 5, Massachusetts Institute of Technology 43

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D5Mit43	b	smaller than f	C57BL/6J
	c	132bp	C3HeB/FeJLe
	f	larger than c and b	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit43	a	13bp	DBA/2J
	b	110bp	CAST/EiJ
	c	132bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, SPRET/EiJ
	d	136bp	NOD/MrkTac
	e	140bp	NON/ShiLt
	f	148bp	BALB/cJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit43	l	smaller	LG/J
	D5Mit43	s	larger	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24