About   Help   FAQ
D5Mit43 Primer Detail
Primers
  • Name
    D5Mit43
  • Primer 1 Sequence
    TTATAGGCACGAACTGTCATGC
  • Primer 2 Sequence
    GTCCCCTCACCCACTTGTAA
  • ID
    MGI:702116
  • Product Size
    131
  • Other IDs
    D5Mit43 (BROAD)
  • Note
    MIT assay: B423
    Additional information: MIT STS Marker Data Files
Genes
D5Mit43 DNA segment, Chr 5, Massachusetts Institute of Technology 43
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D5Mit43 b smaller than f C57BL/6J
c 132bp C3HeB/FeJLe
f larger than c and b FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit43 a 13bp DBA/2J
b 110bp CAST/EiJ
c 132bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, SPRET/EiJ
d 136bp NOD/MrkTac
e 140bp NON/ShiLt
f 148bp BALB/cJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D5Mit43 l smaller LG/J
s larger SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory