D11Mit29 Primer Detail MGI Mouse MGI:702038

D11Mit29 Primer Detail

Name

D11Mit29
Primer 1 Sequence

TTGAGGCATGAGGGGATTAG
Primer 2 Sequence

TTTCCGTCATTGCTAAAGGG
ID

MGI:702038
Product Size

147
Other IDs

D11Mit29 (BROAD)
Note

MIT assay: D510
Additional information: MIT STS Marker Data Files

D11Mit29

DNA segment, Chr 11, Massachusetts Institute of Technology 29

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit29	a	138bp	CAST/EiJ, DBA/2J
	b	142bp	SPRET/EiJ
	c	144bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	150bp	BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	e	156bp	AKR/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D11Mit29	a	156bp	A.CA/W, AKR/W
	b	150bp	129/SvW, BALB/cW, BN/aW, C3H/W, CBA/W
	c	144bp	C57BL/6W, C57BL/10W
	d	138bp	DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23