About   Help   FAQ
D11Mit29 Primer Detail
Primers
  • Name
    D11Mit29
  • Primer 1 Sequence
    TTGAGGCATGAGGGGATTAG
  • Primer 2 Sequence
    TTTCCGTCATTGCTAAAGGG
  • ID
    MGI:702038
  • Product Size
    147
  • Other IDs
    D11Mit29 (BROAD)
  • Note
    MIT assay: D510
    Additional information: MIT STS Marker Data Files
Genes
D11Mit29 DNA segment, Chr 11, Massachusetts Institute of Technology 29
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit29 a 138bp CAST/EiJ, DBA/2J
b 142bp SPRET/EiJ
c 144bp B6.Cg-Lepob/+, C57BL/6J
d 150bp BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
e 156bp AKR/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D11Mit29 a 156bp A.CA/W, AKR/W
b 150bp 129/SvW, BALB/cW, BN/aW, C3H/W, CBA/W
c 144bp C57BL/6W, C57BL/10W
d 138bp DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory