D11Mit26 Primer Detail MGI Mouse MGI:702024

D11Mit26 Primer Detail

Name

D11Mit26
Primer 1 Sequence

CTCTACAAGCACCTGCCCTC
Primer 2 Sequence

TATTTCTCAAAGCTGTCACTTTGC
ID

MGI:702024
Product Size

191
Other IDs

D11Mit26 (BROAD)
Note

MIT assay: B161
Additional information: MIT STS Marker Data Files

D11Mit26

DNA segment, Chr 11, Massachusetts Institute of Technology 26

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit26	a	largest	C57BL/6, DBA/2
Not Specified	D11Mit26	b	smaller	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit26	a	170bp	CAST/EiJ
	b	176bp	A/J, C3H/HeJ
	c	184bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J
	d	196bp	LP/J
	e	200bp	SPRET/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23