About   Help   FAQ
D4Mit142 Primer Detail
Primers
  • Name
    D4Mit142
  • Primer 1 Sequence
    TGCTTGCTCAATGGAACTTG
  • Primer 2 Sequence
    CAGAATGCACACATTCACTGC
  • ID
    MGI:702008
  • Product Size
    118
  • Other IDs
    D4Mit142 (BROAD)
  • Note
    MIT assay: MT508
    Additional information: MIT STS Marker Data Files
Genes
D4Mit142 DNA segment, Chr 4, Massachusetts Institute of Technology 142
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit142 a 107bp SPRET/EiJ
b 121bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac
c 123bp AKR/J, NON/ShiLt
d 127bp CAST/EiJ
e 139bp DBA/2J, LP/J
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit142 c 0.135kb CAST/EiJ
p 0.12kb STOCK Whrnwi
w 0.12kb STOCK Whrnwi
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit142 a larger 129P3/J
s smaller SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory