About   Help   FAQ
D4Mit149 Primer Detail
Primers
  • Name
    D4Mit149
  • Primer 1 Sequence
    TGAATTCAGAAGGATGTGTGTATG
  • Primer 2 Sequence
    ATGTGAGAATCAACACCTGAGG
  • ID
    MGI:702001
  • Product Size
    111
  • Other IDs
    D4Mit149 (BROAD)
  • Note
    MIT assay: MMH335
    Additional information: MIT STS Marker Data Files
Genes
D4Mit149 DNA segment, Chr 4, Massachusetts Institute of Technology 149
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit149 c 130bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit149 a 114bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
b 122bp A/J
c 126bp CAST/EiJ
d 130bp BALB/cJ, C3H/HeJ, DBA/2J, LP/J
e 144bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit149 c 157bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D4Mit149 a 130bp BALB/cW, C3H/W, CBA/W, DBA/2W
b 122bp A.CA/W
c 114bp 129/SvW, AKR/W, BN/aW, C57BL/6W, C57BL/10W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory