About   Help   FAQ
D19Mit108 Primer Detail
Primers
  • Name
    D19Mit108
  • Primer 1 Sequence
    AGGACAGAGAAAGAATGACTCTGG
  • Primer 2 Sequence
    TGTCTTCTGACTACCATGTGTGC
  • ID
    MGI:701987
  • Product Size
    111
  • Other IDs
    D19Mit108 (BROAD)
  • Note
    MIT assay: MTH740
    Additional information: MIT STS Marker Data Files
Genes
D19Mit108 DNA segment, Chr 19, Massachusetts Institute of Technology 108
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit108 a 92bp SPRET/EiJ
b 110bp AKR/J, C3H/HeJ, DBA/2J
c 112bp A/J, B6.Cg-Lepob/+, C57BL/6J
d 114bp BALB/cJ, NOD/MrkTac, NON/ShiLt
e 116bp LP/J
f 120bp CAST/EiJ
J:61322 Montgomery JC, et al., MGI Direct Data Submission. 2000;
Endonuclease Gene Allele Fragments Strains
D19Mit108 a 110bp AEJ/Gn
s 92bp M. spretus
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:61322 Montgomery JC, et al., Chromosomal localization of the mouse G protein-coupled receptor kinase 5 and 6 genes. MGI Direct Data Submission. 2000;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory