D19Mit108 Primer Detail MGI Mouse MGI:701987

D19Mit108 Primer Detail

Name

D19Mit108
Primer 1 Sequence

AGGACAGAGAAAGAATGACTCTGG
Primer 2 Sequence

TGTCTTCTGACTACCATGTGTGC
ID

MGI:701987
Product Size

111
Other IDs

D19Mit108 (BROAD)
Note

MIT assay: MTH740
Additional information: MIT STS Marker Data Files

DNA segment, Chr 19, Massachusetts Institute of Technology 108

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit108	a	92bp	SPRET/EiJ
	b	110bp	AKR/J, C3H/HeJ, DBA/2J
	c	112bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J
	d	114bp	BALB/cJ, NOD/MrkTac, NON/ShiLt
	e	116bp	LP/J
	f	120bp	CAST/EiJ

J:61322 Montgomery JC, et al., MGI Direct Data Submission. 2000;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit108	a	110bp	AEJ/Gn
	D19Mit108	s	92bp	M. spretus

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:61322 Montgomery JC, et al., Chromosomal localization of the mouse G protein-coupled receptor kinase 5 and 6 genes. MGI Direct Data Submission. 2000;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23