D18Mit31 Primer Detail MGI Mouse MGI:701977

D18Mit31 Primer Detail

Name

D18Mit31
Primer 1 Sequence

AGCAGGAAGACCATGAGTATAAGG
Primer 2 Sequence

TGCTGGCATGAGACAAGTTC
ID

MGI:701977
Product Size

113
Other IDs

D18Mit31 (BROAD)
Note

MIT assay: P25
Additional information: MIT STS Marker Data Files

D18Mit31

DNA segment, Chr 18, Massachusetts Institute of Technology 31

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D18Mit31	b	smaller than f	C57BL/6J
	c	118bp	C3HeB/FeJLe
	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit31	a	116bp	LP/J
	b	117bp	SPRET/EiJ
	c	118bp	BALB/cJ, C3H/HeJ, CAST/EiJ
	d	120bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	122bp	NOD/MrkTac, NON/ShiLt
	f	124bp	A/J, AKR/J, DBA/2J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13