About   Help   FAQ
D18Mit32 Primer Detail
Primers
  • Name
    D18Mit32
  • Primer 1 Sequence
    CACCTCTATCCACCTCCTAGG
  • Primer 2 Sequence
    GGAGATTCCATCCCTGCC
  • ID
    MGI:701968
  • Product Size
    160
  • Other IDs
    D18Mit32 (BROAD)
  • Note
    MIT assay: B174
    Additional information: MIT STS Marker Data Files
Genes
D18Mit32 DNA segment, Chr 18, Massachusetts Institute of Technology 32
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit32 a 148bp CAST/EiJ
b 150bp SPRET/EiJ
c 156bp BALB/cJ, C3H/HeJ
d 158bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit32 c 137bp CBA/CaOlaHsd
s 136bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory