About   Help   FAQ
D2Mit323 Primer Detail
Primers
  • Name
    D2Mit323
  • Primer 1 Sequence
    AGAATCCTAAGTGGTGGTTAGAGG
  • Primer 2 Sequence
    ACCCAAAGTTGTCTTTAAGTACACA
  • ID
    MGI:701946
  • Product Size
    125
  • Other IDs
    D2Mit323 (BROAD)
  • Note
    MIT assay: MTAR4040
    Additional information: MIT STS Marker Data Files
Genes
D2Mit323 DNA segment, Chr 2, Massachusetts Institute of Technology 323
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit323 c 110bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit323 a 110bp C3H/HeJ
b 114bp SPRET/EiJ
c 126bp A/J, AKR/J, DBA/2J, NOD/MrkTac, NON/ShiLt
d 128bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
e 134bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit323 c 200bp CBA/CaOlaHsd
s 206bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory