D15Mit15 Primer Detail MGI Mouse MGI:701940

D15Mit15 Primer Detail

Name

D15Mit15
Primer 1 Sequence

AGCATACACTCTCTTGTTCCTGCT
Primer 2 Sequence

AATAAATACCAGAGAAGCACCGTG
ID

MGI:701940
Product Size

145
Other IDs

D15Mit15 (BROAD)
Note

MIT assay: D6
Additional information: MIT STS Marker Data Files

D15Mit15

DNA segment, Chr 15, Massachusetts Institute of Technology 15

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D15Mit15	b	smaller than f	C57BL/6J
	c	164bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit15	a	142bp	AKR/J, DBA/2J
	b	157bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	c	161bp	CAST/EiJ
	d	164bp	C3H/HeJ
	e	166bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24