About   Help   FAQ
D9Mit207 Primer Detail
Primers
  • Name
    D9Mit207
  • Primer 1 Sequence
    TGGGTTCTATTCCCACTCTATTT
  • Primer 2 Sequence
    GAAGACACTGCTGACCTCTGG
  • ID
    MGI:701920
  • Product Size
    147
  • Other IDs
    D9Mit207 (BROAD)
  • Note
    MIT assay: MT3266
    Additional information: MIT STS Marker Data Files
Genes
D9Mit207 DNA segment, Chr 9, Massachusetts Institute of Technology 207
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit207 a 136bp CAST/EiJ
b 146bp SPRET/EiJ
c 148bp BALB/cJ, C57BL/6J, DBA/2J
d 150bp AKR/J, B6.Cg-Lepob/+, NON/ShiLt
e 154bp LP/J
f 160bp NOD/MrkTac
g 162bp A/J, C3H/HeJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D9Mit207 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit207 c 119bp CBA/CaOlaHsd
s 124bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory