D17Mit185 Primer Detail MGI Mouse MGI:701908

D17Mit185 Primer Detail

Name

D17Mit185
Primer 1 Sequence

AAAAGGGACAACATACCCAGG
Primer 2 Sequence

CATCCACTCTGCTTGTATTAGGG
ID

MGI:701908
Product Size

188
Other IDs

D17Mit185 (BROAD)
Note

MIT assay: MT3803
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 185

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit185	a	178bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	184bp	129X1/SvJ
		c	188bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit185	a	162bp	SPRET/EiJ
	b	172bp	CAST/EiJ
	c	178bp	LP/J
	d	184bp	BALB/cJ
	e	186bp	A/J, C3H/HeJ
	f	188bp	AKR/J, B6.Cg-Lep^ob/+, NOD/MrkTac
	g	190bp	C57BL/6J, DBA/2J, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D17Mit185	c	182bp	A/JOlaHsd, AKR/OlaHsd, BALB/cJ
	d	186bp	C57BL/6JOlaHsd, DBA/2J, PWB, SJL/J
	g	170bp	129P3/J
	j	180bp	C3H/HeJ, JF1
	r	184bp	C57BL/10

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24