About   Help   FAQ
D17Mit185 Primer Detail
Primers
  • Name
    D17Mit185
  • Primer 1 Sequence
    AAAAGGGACAACATACCCAGG
  • Primer 2 Sequence
    CATCCACTCTGCTTGTATTAGGG
  • ID
    MGI:701908
  • Product Size
    188
  • Other IDs
    D17Mit185 (BROAD)
  • Note
    MIT assay: MT3803
    Additional information: MIT STS Marker Data Files
Genes
D17Mit185 DNA segment, Chr 17, Massachusetts Institute of Technology 185
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit185 a 178bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 184bp 129X1/SvJ
c 188bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit185 a 162bp SPRET/EiJ
b 172bp CAST/EiJ
c 178bp LP/J
d 184bp BALB/cJ
e 186bp A/J, C3H/HeJ
f 188bp AKR/J, B6.Cg-Lepob/+, NOD/MrkTac
g 190bp C57BL/6J, DBA/2J, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D17Mit185 c 182bp A/JOlaHsd, AKR/OlaHsd, BALB/cJ
d 186bp C57BL/6JOlaHsd, DBA/2J, PWB, SJL/J
g 170bp 129P3/J
j 180bp C3H/HeJ, JF1
r 184bp C57BL/10
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory