D3Mit77 Primer Detail MGI Mouse MGI:701899

D3Mit77 Primer Detail

Name

D3Mit77
Primer 1 Sequence

TCCTGCTGACACCACCAAG
Primer 2 Sequence

AGCACCTACATTTTCCGCAA
ID

MGI:701899
Product Size

150
Other IDs

D3Mit77 (BROAD)
Note

MIT assay: MPC1744
Additional information: MIT STS Marker Data Files

D3Mit77

DNA segment, Chr 3, Massachusetts Institute of Technology 77

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit77	a	150bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J
	b	164bp	A/J, BALB/cJ, C3H/HeJ
	c	166bp	NOD/MrkTac
	d	168bp	NON/ShiLt
	e	170bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D3Mit77	c	151bp	129P3/J, AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
	d	147bp	DBA/2J
	h	169bp	C3H/HeJ
	j	157bp	JF1
	p	127bp	PWB
	w	165bp	A/JOlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/09/2024 MGI 6.23