D12Mit239 Primer Detail MGI Mouse MGI:701862

D12Mit239 Primer Detail

Name

D12Mit239
Primer 1 Sequence

AAAGCATTTCTTGTTTTATGTAATGTG
Primer 2 Sequence

CATGCATCTGCAACTCGC
ID

MGI:701862
Product Size

90
Other IDs

D12Mit239 (BROAD)
Note

MIT assay: MTH636
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 239

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit239	a	88bp	NOD/MrkTac
	b	90bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NON/ShiLt
	c	100bp	A/J, AKR/J, C3H/HeJ, LP/J
	d	102bp	DBA/2J
	e	104bp	CAST/EiJ
	f	114bp	SPRET/EiJ

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit239	b	lower	C57BL/6J
	D12Mit239	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24