D12Mit233 Primer Detail MGI Mouse MGI:701856

D12Mit233 Primer Detail

Name

D12Mit233
Primer 1 Sequence

AGGCTCACAGAAAAAGTGAACC
Primer 2 Sequence

TGAAGCAGTCTGACCAGGTG
ID

MGI:701856
Product Size

148
Other IDs

D12Mit233 (BROAD)
Note

MIT assay: MT3192
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 233

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit233	a	140bp	A/J
	b	142bp	DBA/2J
	c	146bp	CAST/EiJ, NON/ShiLt
	d	150bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	e	158bp	SPRET/EiJ
	f	170bp	NOD/MrkTac
	g	172bp	AKR/J, C3H/HeJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit233	c	larger	CBA/Kw
	D12Mit233	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23