About   Help   FAQ
D11Mit111 Primer Detail
Primers
  • Name
    D11Mit111
  • Primer 1 Sequence
    GAAGGTAAGTGGACCTGAGGG
  • Primer 2 Sequence
    GCATTTCTCATTCAGATTCGTG
  • ID
    MGI:701845
  • Product Size
    137
  • Other IDs
    D11Mit111 (BROAD)
  • Note
    MIT assay: D781
    Additional information: MIT STS Marker Data Files
Genes
D11Mit111 DNA segment, Chr 11, Massachusetts Institute of Technology 111
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit111 a largest C57BL/6, DBA/2
b smaller JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit111 a 132bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J
b 134bp NON/ShiLt
c 135bp DBA/2J, SPRET/EiJ
d 136bp NOD/MrkTac
e 137bp CAST/EiJ
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/22/2024
MGI 6.24
The Jackson Laboratory