About   Help   FAQ
D6Mit52 Primer Detail
Primers
  • Name
    D6Mit52
  • Primer 1 Sequence
    TAAGTCAGCCCAAGGAAGTCA
  • Primer 2 Sequence
    AAGGCACCTATATTTGTGCACA
  • ID
    MGI:701843
  • Product Size
    144
  • Other IDs
    D6Mit52 (BROAD)
  • Note
    MIT assay: B681
    Additional information: MIT STS Marker Data Files
Genes
D6Mit52 DNA segment, Chr 6, Massachusetts Institute of Technology 52
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit52 a 126bp NOD/MrkTac
b 142bp A/J, AKR/J, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J
c 144bp BALB/cJ
d 146bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D6Mit52 b 142bp C57BL/6JOlaHsd
d 138bp 129P3/J, AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
j 144bp JF1
l 122bp SJL/J
p 140bp C57BL/10, PWB
w 134bp A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory