About   Help   FAQ
D6Mit58 Primer Detail
Primers
  • Name
    D6Mit58
  • Primer 1 Sequence
    CTGCTGGAGATAAAAACACATACA
  • Primer 2 Sequence
    CTCCCCCTCCTGCTCTTC
  • ID
    MGI:701834
  • Product Size
    115
  • Other IDs
    D6Mit58 (BROAD)
  • Note
    MIT assay: MPC615
    Additional information: MIT STS Marker Data Files
Genes
D6Mit58 DNA segment, Chr 6, Massachusetts Institute of Technology 58
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit58 a 96bp SPRET/EiJ
b 108bp NOD/MrkTac
c 114bp LP/J
d 116bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
e 120bp CAST/EiJ
f 124bp NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D6Mit58 l larger LG/J
s smaller SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory