About   Help   FAQ
D13Mit67 Primer Detail
Primers
  • Name
    D13Mit67
  • Primer 1 Sequence
    TTTCATGGAGTCGAGTATTTTGG
  • Primer 2 Sequence
    ATCTTGCATAGAACCTTTGGATG
  • ID
    MGI:701810
  • Product Size
    159
  • Other IDs
    D13Mit67 (BROAD)
  • Note
    MIT assay: MPC1370
    Additional information: MIT STS Marker Data Files
Genes
D10Mit1011 DNA segment, Chr 10, Massachusetts Institute of Technology 1011
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit1011 a 140bp A/J, BALB/cJ, LP/J, NOD/MrkTac
b 142bp CAST/EiJ
c 152bp B6.Cg-Lepob/+, C57BL/6J
d 160bp C3H/HeJ, NON/ShiLt
e 162bp AKR/J, DBA/2J, SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit1011 a 166bp AKR/OlaHsd
b 160bp C57BL/6JOlaHsd, JF1, SJL/J
c 170bp A/JOlaHsd, BALB/cJ
d 168bp DBA/2J
g 154bp 129P3/J
h 146bp C3H/HeJ
p 134bp PWB
r 150bp C57BL/10
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory