D13Mit64 Primer Detail MGI Mouse MGI:701807

D13Mit64 Primer Detail

Name

D13Mit64
Primer 1 Sequence

CCTCAGCACCAAAAAAGGAC
Primer 2 Sequence

ACATCAGTGACCAGGCATCA
ID

MGI:701807
Product Size

103
Other IDs

D13Mit64 (BROAD)
Note

MIT assay: MPC932
Additional information: MIT STS Marker Data Files

D13Mit64

DNA segment, Chr 13, Massachusetts Institute of Technology 64

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit64	a	102bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	b	110bp	A/J, BALB/cJ, LP/J, NON/ShiLt
	c	112bp	CAST/EiJ
	d	116bp	C3H/HeJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D13Mit64	c	113bp	129P3/J, A/JOlaHsd, BALB/cJ, SJL/J
	d	105bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	h	119bp	C3H/HeJ
	j	127bp	JF1
	p	107bp	PWB

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit64	c	larger	CBA/Kw
	D13Mit64	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23