About   Help   FAQ
D13Mit63 Primer Detail
Primers
  • Name
    D13Mit63
  • Primer 1 Sequence
    GAGATGGAAGGAAGAGATGGC
  • Primer 2 Sequence
    CAAATGCATGTATCCGTATGTG
  • ID
    MGI:701806
  • Product Size
    139
  • Other IDs
    D13Mit63 (BROAD)
  • Note
    MIT assay: MPC1609
    Additional information: MIT STS Marker Data Files
Genes
D13Mit63 DNA segment, Chr 13, Massachusetts Institute of Technology 63
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit63 a 136bp CAST/EiJ
b 142bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
c 146bp A/J, BALB/cJ, C3H/HeJ, LP/J
d 148bp DBA/2J, NOD/MrkTac, NON/ShiLt
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D13Mit63 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory