D13Mit63 Primer Detail MGI Mouse MGI:701806

D13Mit63 Primer Detail

Name

D13Mit63
Primer 1 Sequence

GAGATGGAAGGAAGAGATGGC
Primer 2 Sequence

CAAATGCATGTATCCGTATGTG
ID

MGI:701806
Product Size

139
Other IDs

D13Mit63 (BROAD)
Note

MIT assay: MPC1609
Additional information: MIT STS Marker Data Files

D13Mit63

DNA segment, Chr 13, Massachusetts Institute of Technology 63

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit63	a	136bp	CAST/EiJ
	b	142bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	c	146bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	d	148bp	DBA/2J, NOD/MrkTac, NON/ShiLt

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit63	c	smaller	CBA/Kw
	D13Mit63	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23