D13Mit61 Primer Detail MGI Mouse MGI:701804

D13Mit61 Primer Detail

Name

D13Mit61
Primer 1 Sequence

TGCTCCAATACAACAAGGTCC
Primer 2 Sequence

CCAGCCAAGGTGTGTTGAC
ID

MGI:701804
Product Size

164
Other IDs

D13Mit61 (BROAD)
Note

MIT assay: MPC474
Additional information: MIT STS Marker Data Files

D13Mit61

DNA segment, Chr 13, Massachusetts Institute of Technology 61

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit61	m	166bp	MOLF/EiJ
Not Specified	D13Mit61	s	180bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit61	a	166bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
	b	180bp	NOD/MrkTac
	c	192bp	CAST/EiJ
	d	202bp	SPRET/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24