About   Help   FAQ
D13Mit157 Primer Detail
Primers
  • Name
    D13Mit157
  • Primer 1 Sequence
    ACACACCAGTTTGTTTTGTTCG
  • Primer 2 Sequence
    AGCGTGGGAAAACACAGAAG
  • ID
    MGI:701771
  • Product Size
    142
  • Other IDs
    D13Mit157 (BROAD)
  • Note
    MIT assay: MT1321
    Additional information: MIT STS Marker Data Files
Genes
D13Mit157 DNA segment, Chr 13, Massachusetts Institute of Technology 157
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit157 a 119bp SPRET/EiJ
b 123bp CAST/EiJ
c 137bp A/J, LP/J
d 139bp BALB/cJ, NOD/MrkTac, NON/ShiLt
e 143bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
J:61322 Montgomery JC, et al., MGI Direct Data Submission. 2000;
Endonuclease Gene Allele Fragments Strains
D13Mit157 a 150bp AEJ/Gn
s 119bp M. spretus
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:61322 Montgomery JC, et al., Chromosomal localization of the mouse G protein-coupled receptor kinase 5 and 6 genes. MGI Direct Data Submission. 2000;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory