About   Help   FAQ
D6Mit295 Primer Detail
Primers
  • Name
    D6Mit295
  • Primer 1 Sequence
    TGGTACAGGGCACTGTCATC
  • Primer 2 Sequence
    GACCCAATCTGCAAATATTATGC
  • ID
    MGI:701726
  • Product Size
    109
  • Other IDs
    D6Mit295 (BROAD)
  • Note
    MIT assay: MT5264
    Additional information: MIT STS Marker Data Files
Genes
D6Mit295 DNA segment, Chr 6, Massachusetts Institute of Technology 295
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit295 a 118bp 129X1/Sv
f 80, 112, 118bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit295 a 80bp LP/J
b 86bp AKR/J
c 108bp CAST/EiJ
d 112bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
e 118bp A/J, BALB/cJ, NON/ShiLt
f 122bp NOD/MrkTac
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory