D6Mit295 Primer Detail MGI Mouse MGI:701726

D6Mit295 Primer Detail

Name

D6Mit295
Primer 1 Sequence

TGGTACAGGGCACTGTCATC
Primer 2 Sequence

GACCCAATCTGCAAATATTATGC
ID

MGI:701726
Product Size

109
Other IDs

D6Mit295 (BROAD)
Note

MIT assay: MT5264
Additional information: MIT STS Marker Data Files

D6Mit295

DNA segment, Chr 6, Massachusetts Institute of Technology 295

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit295	a	118bp	129X1/Sv
Not Specified	D6Mit295	f	80, 112, 118bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit295	a	80bp	LP/J
	b	86bp	AKR/J
	c	108bp	CAST/EiJ
	d	112bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J
	e	118bp	A/J, BALB/cJ, NON/ShiLt
	f	122bp	NOD/MrkTac

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24