D16Mit48 Primer Detail MGI Mouse MGI:701678

D16Mit48 Primer Detail

Name

D16Mit48
Primer 1 Sequence

ACTAAACAAAATGGCAGGCG
Primer 2 Sequence

CAGAGAAACAATTTTTTTCAGGTG
ID

MGI:701678
Product Size

160
Other IDs

D16Mit48 (BROAD)
Note

MIT assay: MPC515
Additional information: MIT STS Marker Data Files

D16Mit48

DNA segment, Chr 16, Massachusetts Institute of Technology 48

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit48	c	164bp	C3HeB/FeJLe
	D16Mit48	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit48	a	154bp	SPRET/EiJ
	b	158bp	AKR/J, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	160bp	B6.Cg-Lep^ob/+
	d	164bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J
	e	176bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24