D16Mit49 Primer Detail MGI Mouse MGI:701677

D16Mit49 Primer Detail

Name

D16Mit49
Primer 1 Sequence

AATGTTCACACTTCAACCTTGG
Primer 2 Sequence

CAAGCAACTGACCACTTACTTTAA
ID

MGI:701677
Product Size

150
Other IDs

D16Mit49 (BROAD)
Note

MIT assay: MPC978
Additional information: MIT STS Marker Data Files

D16Mit49

DNA segment, Chr 16, Massachusetts Institute of Technology 49

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit49	a	168bp	129X1/Sv
Not Specified	D16Mit49	f	146, 168bp	CD-1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit49	m	195bp	MOLF/EiJ
Not Specified	D16Mit49	s	173bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit49	a	146bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	b	152bp	A/J, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	168bp	LP/J
	d	172bp	CAST/EiJ
	e	180bp	SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D16Mit49	c	larger	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13