About   Help   FAQ
D16Mit49 Primer Detail
Primers
  • Name
    D16Mit49
  • Primer 1 Sequence
    AATGTTCACACTTCAACCTTGG
  • Primer 2 Sequence
    CAAGCAACTGACCACTTACTTTAA
  • ID
    MGI:701677
  • Product Size
    150
  • Other IDs
    D16Mit49 (BROAD)
  • Note
    MIT assay: MPC978
    Additional information: MIT STS Marker Data Files
Genes
D16Mit49 DNA segment, Chr 16, Massachusetts Institute of Technology 49
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit49 a 168bp 129X1/Sv
f 146, 168bp CD-1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit49 m 195bp MOLF/EiJ
s 173bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit49 a 146bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
b 152bp A/J, DBA/2J, NOD/MrkTac, NON/ShiLt
c 168bp LP/J
d 172bp CAST/EiJ
e 180bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D16Mit49 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory