About   Help   FAQ
D8Mit104 Primer Detail
Primers
  • Name
    D8Mit104
  • Primer 1 Sequence
    GAAAGCAAACTTCTAAAGGATTATATG
  • Primer 2 Sequence
    TGCAAATTCTCAAACTGATACCC
  • ID
    MGI:701663
  • Product Size
    143
  • Other IDs
    D8Mit104 (BROAD)
  • Note
    MIT assay: MPC2609
    Additional information: MIT STS Marker Data Files
Genes
D8Mit104 DNA segment, Chr 8, Massachusetts Institute of Technology 104
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit104 a 132bp BALB/cJ, LP/J, NOD/MrkTac
b 134bp AKR/J
c 138bp C3H/HeJ, DBA/2J, NON/ShiLt
d 140bp CAST/EiJ
e 145bp B6.Cg-Lepob/+, C57BL/6J
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D8Mit104 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory