About   Help   FAQ
DXMit22 Primer Detail
Primers
  • Name
    DXMit22
  • Primer 1 Sequence
    CCATGCTCACAGGCACAC
  • Primer 2 Sequence
    CAGGCTGGGCTACAGAAGAC
  • ID
    MGI:701646
  • Product Size
    236
  • Other IDs
    DXMit22 (BROAD)
  • Note
    MIT assay: D585
    Additional information: MIT STS Marker Data Files
Genes
DXMit22 DNA segment, Chr X, Massachusetts Institute of Technology 22
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit22 a 236bp 129X1/Sv
f 244bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit22 a 236bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, SPRET/EiJ
b 244bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
c 264bp CAST/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
DXMit22 c smaller CBA/Kw
e larger KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory