About   Help   FAQ
D18Mit120 Primer Detail
Primers
  • Name
    D18Mit120
  • Primer 1 Sequence
    ACTGCACTGGTCCCATTTTC
  • Primer 2 Sequence
    CAATAGTTGGAAATCAGACAGGC
  • ID
    MGI:701608
  • Product Size
    174
  • Other IDs
    D18Mit120 (BROAD)
  • Note
    MIT assay: MT1457
    Additional information: MIT STS Marker Data Files
Genes
D18Mit120 DNA segment, Chr 18, Massachusetts Institute of Technology 120
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit120 m 166bp MOLF/EiJ
s 176bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit120 a 154bp A/J, BALB/cJ, DBA/2J
b 156bp C3H/HeJ, NOD/MrkTac, NON/ShiLt
c 158bp CAST/EiJ
d 178bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J
e 210bp SPRET/EiJ
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory