About   Help   FAQ
D18Mit121 Primer Detail
Primers
  • Name
    D18Mit121
  • Primer 1 Sequence
    GTGACTGACAACACAAGGAAGTG
  • Primer 2 Sequence
    AGTGTAGGCATCACGTGCAG
  • ID
    MGI:701607
  • Product Size
    90
  • Other IDs
    D18Mit121 (BROAD)
  • Note
    MIT assay: MT2660
    Additional information: MIT STS Marker Data Files
Genes
D18Mit121 DNA segment, Chr 18, Massachusetts Institute of Technology 121
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit121 a 76bp SPRET/EiJ
b 84bp B6.Cg-Lepob/+
c 86bp A/J, CAST/EiJ
d 88bp BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
e 90bp LP/J
f 94bp NON/ShiLt
g 96bp NOD/MrkTac
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit121 a smaller 129P3/J
s larger SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory